1987;80:283C287

1987;80:283C287. a and c) or, more importantly, against nontypeable (NTHI) strains, which are a common cause of neonatal sepsis and otitis media in children (5, 11, 27). To achieve broader protection against various immunogen is required. One potential antigen is the 80-kDa minor outer membrane protein of meningitis infection (29). In addition, affinity-purified antibodies prepared against native D15 were shown to be protective in the infant rat model of bacteremia (29). In a recent study (18), rabbit antisera raised against a recombinant full-length D15 (rD15) expressed in were shown to cross-react with serotypes a, b, c, d, e, and f and NTHI. Furthermore, these antisera were also capable of protecting infant rats against bacteremia caused by Hib or type a (Hia). Thus, Soyasaponin BB D15 appears to be an attractive candidate antigen to be included in a vaccine that would provide broader protection against BTA282, used for lysogenic growth of recombinant bacteriophage lambda, and the cloning vector lambda gt11 Amp1 have been previously described (4, 28). Hib strain MinnA was kindly provided by R. S. Munson, Jr. (Childrens Hospital Research Foundation, Columbus, Ohio). Hia strain ATCC 9006 was purchased from the American Type Culture Collection. Hia, Hib, and NTHI were grown as described earlier (18). Construction and expression of a GST-tD15 fusion protein. Purification of genomic DNA from Hib strain Ca and cloning of the D15 gene were described previously (28). A forward sense primer (5GGGGAATTCCAAAAGATGTTCGT3) and a reverse antisense primer (5CACGAATTCCCTGCAAATC3) were used to amplify a 600-bp fragment of Hib DNA (Ca isolate) by PCR. This fragment encodes amino acid residues 25 to 220 of the D15 protein (Fig. ?(Fig.1).1). The PCR product was purified, digested with TG-1. Colonies expressing tD15 linked to the C terminus of glutathione cells were grown in YT medium to an for 10 min at 4C and used to purify the GST-tD15 fusion protein. Open in a separate window FIG. 1 Serpine1 Soyasaponin BB Amino acid sequence of tD15, based on the nucleotide sequence of the D15 gene obtained by Flack et al. (12). The signal peptide cleavage site, the expected starting position of the GST-tD15 fusion, a cryptic thrombin cleavage site, and the termination of tD15 are all indicated with arrows. The underlined sequences represent the synthetic tD15 peptides (peptides 2 to 9). Purification of the GST-tD15 fusion protein from Purification of the GST fusion protein was performed as previously described by Smith and Johnson (25), with some modifications. Briefly, the cell pellet from 2 liters of culture was sonicated for 10 min with 20 ml of phosphate-buffered saline (PBS; pH 7.4) containing 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine, and 0.02 mg of soybean trypsin inhibitor ml?1. The homogenate was centrifuged at 10,000 for 10 min. The supernatant was saved, and the pellet was subjected to a second extraction. The two supernatants were combined, and Triton X-100 was added to a final concentration of 1%. The combined supernatant was loaded onto a 4-ml glutathione-Sepharose 4B column (Pharmacia) equilibrated in PBS containing 1% Triton X-100. The column was washed with 50 ml of PBSC1% Triton X-100. The GST-tD15 fusion protein was eluted with 50 mM Tris-HCl (pH 8.0) containing 5 mM glutathione. The purity of the protein was assessed by discontinuous sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) through an SDSC12.5% polyacrylamide gel as described by Laemmli (16), and proteins were visualized by using Rapid Coomassie Blue (Diversified Biotech). Isolation of tD15 from the GST-tD15 fusion protein. The purified GST-tD15 fusion protein solution (30 ml) was concentrated in Centriprep 10 concentrators (Amicon) to Soyasaponin BB about 5 ml at 4C. The solution was dialyzed against 50 mM Tris-HCl (pH 8.5) at 4C overnight and then treated with 25 U of human thrombin (T-3010; Sigma) per ml of solution at 37C for 2 h. The reaction was stopped by placing the solution on ice until it was loaded directly onto a glutathione-Sepharose 4B affinity column (2 ml) equilibrated with PBS containing 1% Triton X-100. The tD15 fragment was collected in the run-through fraction. The column was.